Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2011168
End position: 2011191
Length: 24

DNA sequence
>NC_020895, from 2011168 to 2011191 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGCGTCCGTGTCCGTGTCCGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2007162-2017679	Sequence	SHJGH_1672 - modular polyketide synthase (Protein is coded in complementary strand; from 2017679 to 2007162)