Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2139009
End position: 2139032
Length: 24

DNA sequence
>NC_020895, from 2139009 to 2139032 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGGGCGGCGGTGCGGCGGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2137548-2139155	Sequence	SHJGH_1757 - putative adenosine deaminase (Protein is coded in complementary strand; from 2139155 to 2137548)