Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2321554
End position: 2321577
Length: 24

DNA sequence
>NC_020895, from 2321554 to 2321577 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCACTACGGCACTACTGCACTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2321575-2322567	Sequence	SHJGH_1931 - putative ion channel subunit (Protein is coded in complementary strand; from 2322567 to 2321575)