Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2349568
End position: 2349591
Length: 24

DNA sequence
>NC_020895, from 2349568 to 2349591 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CATCGTCATCGGCCTCGTCATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2349543-2349806	Sequence	SHJGH_1956 - membrane protein