Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2350660
End position: 2350683
Length: 24

DNA sequence
>NC_020895, from 2350660 to 2350683 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGCCGTCCGGCCGTACCGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2350657-2351028	Sequence	SHJGH_1958 - MerR family transcriptional regulator (Protein is coded in complementary strand; from 2351028 to 2350657)