Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2363351
End position: 2363374
Length: 24

DNA sequence
>NC_020895, from 2363351 to 2363374 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGCCCAGCCGCCCAGCCGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2363329-2364759	Sequence	SHJGH_1970 - magnesium or manganese-dependent protein phosphatase