Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2423237
End position: 2423260
Length: 24

DNA sequence
>NC_020895, from 2423237 to 2423260 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGCGGGCGGGGGCGCTGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2422794-2423804	Sequence	SHJGH_2021 - transferase (Protein is coded in complementary strand; from 2423804 to 2422794)