Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2564398
End position: 2564421
Length: 24

DNA sequence
>NC_020895, from 2564398 to 2564421 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGGTGGCGATGGCGGTGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2563799-2568544	Sequence	SHJGH_2153 - putative RHS-repeat protein