Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2611465
End position: 2611488
Length: 24

DNA sequence
>NC_020895, from 2611465 to 2611488 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGACGGCGGCGGCGTCGGAGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2610035-2613958	Sequence	SHJGH_2187 - hypothetical protein (Protein is coded in complementary strand; from 2613958 to 2610035)