Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2677382
End position: 2677405
Length: 24

DNA sequence
>NC_020895, from 2677382 to 2677405 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGGCGGCGGCCGAGGCGACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2676776-2677561	Sequence	SHJGH_2244 - glutamate racemase (Protein is coded in complementary strand; from 2677561 to 2676776)