Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2917568
End position: 2917591
Length: 24

DNA sequence
>NC_020895, from 2917568 to 2917591 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGCGGCGGCGGCGGTGGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2916856-2917956	Sequence	SHJGH_2479 - two-component system sensor kinase (Protein is coded in complementary strand; from 2917956 to 2916856)