Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2918173
End position: 2918196
Length: 24

DNA sequence
>NC_020895, from 2918173 to 2918196 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGCTCCGGCGCCCCGGCGCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2917953-2918606	Sequence	SHJGH_2480 - two-component system response regulator (Protein is coded in complementary strand; from 2918606 to 2917953)