Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2958676
End position: 2958699
Length: 24

DNA sequence
>NC_020895, from 2958676 to 2958699 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCCGTGGCCCTGGCCCTCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2958225-2958908	Sequence	SHJGH_2520 - uracil-DNA glycosylase (Protein is coded in complementary strand; from 2958908 to 2958225)