Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3152350
End position: 3152373
Length: 24

DNA sequence
>NC_020895, from 3152350 to 3152373 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CTCCGGCTCGGGCTCCGGCTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3151154-3152761	Sequence	SHJGH_2687 - integral membrane protein (Protein is coded in complementary strand; from 3152761 to 3151154)