Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3299512
End position: 3299535
Length: 24

DNA sequence
>NC_020895, from 3299512 to 3299535 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCGGGCTCGGGTTCCGGCTCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3299296-3300894	Sequence	SHJGH_2830 - integral membrane protein (Protein is coded in complementary strand; from 3300894 to 3299296)