Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3393825
End position: 3393848
Length: 24

DNA sequence
>NC_020895, from 3393825 to 3393848 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCCCTGCCGCCCCGCCGCCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3393287-3393958	Sequence	SHJGH_2920 - hypothetical protein (Protein is coded in complementary strand; from 3393958 to 3393287)