Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 344016
End position: 344039
Length: 24

DNA sequence
>NC_020895, from 344016 to 344039 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCCGCGTCCGCCCCCGCGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 343745-344797	Sequence	SHJGH_0270 - putative integral membrane protein (Protein is coded in complementary strand; from 344797 to 343745)