Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3480659
End position: 3480682
Length: 24

DNA sequence
>NC_020895, from 3480659 to 3480682 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGCGGCGGCCGTGGCGGCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3480421-3481467	Sequence	SHJGH_3001 - iron-siderophore uptake system permease protein (Protein is coded in complementary strand; from 3481467 to 3480421)