Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4008127
End position: 4008150
Length: 24

DNA sequence
>NC_020895, from 4008127 to 4008150 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GACCTTGGCCTTGTCCTTGATCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4007414-4008688	Sequence	SHJGH_3486 - maltose-binding protein (Protein is coded in complementary strand; from 4008688 to 4007414)