Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4263857
End position: 4263880
Length: 24

DNA sequence
>NC_020895, from 4263857 to 4263880 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CACCGGCGCCGGCTCCGGCATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4263823-4264590	Sequence	SHJGH_3727 - dehydrogenase (secreted protein)