Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4280696
End position: 4280719
Length: 24

DNA sequence
>NC_020895, from 4280696 to 4280719 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CTTCGGCATCGGCTTCGGCTTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4279642-4281060	Sequence	SHJGH_3740 - efflux membrane protein