Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4314448
End position: 4314471
Length: 24

DNA sequence
>NC_020895, from 4314448 to 4314471 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCGCGCTCGCGGTCGTGCTGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4314121-4315077	Sequence	SHJGH_3774 - ABC transporter permease protein