Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4315186
End position: 4315209
Length: 24

DNA sequence
>NC_020895, from 4315186 to 4315209 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGTCGTCATCGTCGTCGCCGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4315077-4317074	Sequence	SHJGH_3775 - ABC transporter permease protein