Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 435602
End position: 435625
Length: 24

DNA sequence
>NC_020895, from 435602 to 435625 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGGATCGGTATCTGGATCAGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 435597-436994	Sequence	SHJGH_0354 - two-component system sensor kinase (Protein is coded in complementary strand; from 436994 to 435597)