Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 449819
End position: 449842
Length: 24

DNA sequence
>NC_020895, from 449819 to 449842 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGTCGGGGTCGGGGTGGGGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 449020-450279	Sequence	SHJGH_0363 - hypothetical protein (Protein is coded in complementary strand; from 450279 to 449020)