Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4519613
End position: 4519636
Length: 24

DNA sequence
>NC_020895, from 4519613 to 4519636 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCTCCTGCTCCTGCTCCTGCTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4519597-4520142	Sequence	SHJGH_3957 - single-strand DNA-binding protein (Protein is coded in complementary strand; from 4520142 to 4519597)