Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4528132
End position: 4528155
Length: 24

DNA sequence
>NC_020895, from 4528132 to 4528155 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGACGGCTACGGCAACGGCTACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4527849-4528163	Sequence	SHJGH_3962 - putative small membrane protein