Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4725773
End position: 4725796
Length: 24

DNA sequence
>NC_020895, from 4725773 to 4725796 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CTTGCCCTTGCCCTTGCCCTTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4723440-4726241	Sequence	SHJGH_4136 - penicillin-binding protein (Protein is coded in complementary strand; from 4726241 to 4723440)