Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4731653
End position: 4731676
Length: 24

DNA sequence
>NC_020895, from 4731653 to 4731676 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGACGGCGTCGGCGAGTGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4731348-4732082	Sequence	SHJGH_4142 - ribonuclease PH (Protein is coded in complementary strand; from 4732082 to 4731348)