Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4788300
End position: 4788323
Length: 24

DNA sequence
>NC_020895, from 4788300 to 4788323 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGGGTCGGGTTCGTGGTCGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4787989-4788768	Sequence	SHJGH_4196 - hypothetical protein (Protein is coded in complementary strand; from 4788768 to 4787989)