Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4851645
End position: 4851668
Length: 24

DNA sequence
>NC_020895, from 4851645 to 4851668 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGGCACCGGCCCCCGCACCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4849950-4851965	Sequence	SHJGH_4240 - two-component system histidine kinase (Protein is coded in complementary strand; from 4851965 to 4849950)