Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5011248
End position: 5011271
Length: 24

DNA sequence
>NC_020895, from 5011248 to 5011271 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCTGCGGCTGCTGCGGCGGCTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5009540-5011357	Sequence	SHJGH_4377 - secreted protein (Protein is coded in complementary strand; from 5011357 to 5009540)