Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5016135
End position: 5016158
Length: 24

DNA sequence
>NC_020895, from 5016135 to 5016158 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCCCCGCCACCGGCCCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5016124-5017017	Sequence	SHJGH_4381 - 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase (Protein is coded in complementary strand; from 5017017 to 5016124)