Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5048084
End position: 5048107
Length: 24

DNA sequence
>NC_020895, from 5048084 to 5048107 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCTGGCGCTCGCGCAGGCGCTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5047546-5048727	Sequence	SHJGH_4409 - hypothetical protein (Protein is coded in complementary strand; from 5048727 to 5047546)