Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5181354
End position: 5181377
Length: 24

DNA sequence
>NC_020895, from 5181354 to 5181377 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGTACGCGTACCCGTTCCCGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5181144-5183249	Sequence	SHJGH_4530 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 5183249 to 5181144)