Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5342138
End position: 5342161
Length: 24

DNA sequence
>NC_020895, from 5342138 to 5342161 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGGTGGCGTTCGCGGTGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5342071-5343525	Sequence	SHJGH_4691 - two-component system sensor kinase