Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5414305
End position: 5414328
Length: 24

DNA sequence
>NC_020895, from 5414305 to 5414328 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CACGGTCGCGGTCCCGGTCGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5413938-5416142	Sequence	SHJGH_4745 - ATP-dependent RNA helicase (Protein is coded in complementary strand; from 5416142 to 5413938)