Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5424463
End position: 5424486
Length: 24

DNA sequence
>NC_020895, from 5424463 to 5424486 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGGCGAGAGCGAGGACGAGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5424336-5424812	Sequence	SHJGH_4754 - hypothetical protein (Protein is coded in complementary strand; from 5424812 to 5424336)