Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 553335
End position: 553358
Length: 24

DNA sequence
>NC_020895, from 553335 to 553358 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGTGCCGGTGCCGGCGCCGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 553293-554474	Sequence	SHJGH_0452 - pyrroloquinoline quinone biosynthesis protein PqqE (Protein is coded in complementary strand; from 554474 to 553293)