Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5743177
End position: 5743200
Length: 24

DNA sequence
>NC_020895, from 5743177 to 5743200 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CTCGGGCTCGGGCTCGGGCTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5741864-5743453	Sequence	SHJGH_5045 - hypothetical protein (Protein is coded in complementary strand; from 5743453 to 5741864)