Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5773390
End position: 5773413
Length: 24

DNA sequence
>NC_020895, from 5773390 to 5773413 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCAGTCGCCGTCGCAGTCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5768212-5773431	Sequence	SHJGH_5069 - Putative ATP/GTP binding protein