Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5909414
End position: 5909437
Length: 24

DNA sequence
>NC_020895, from 5909414 to 5909437 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCCGCCCCCGTGCCCGCCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5909408-5911714	Sequence	SHJGH_5195 - penicillin-binding protein (Protein is coded in complementary strand; from 5911714 to 5909408)