Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5933185
End position: 5933208
Length: 24

DNA sequence
>NC_020895, from 5933185 to 5933208 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGAGGCCGAGGGCGGGGCCGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5932350-5933336	Sequence	SHJGH_5214 - carbon monoxide dehydrogenase accessory protein (Protein is coded in complementary strand; from 5933336 to 5932350)