Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6059209
End position: 6059232
Length: 24

DNA sequence
>NC_020895, from 6059209 to 6059232 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 AGGGCGAGCGCGATGGCGAGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6058936-6060345	Sequence	SHJGH_5340 - DNA repair protein RadA (Protein is coded in complementary strand; from 6060345 to 6058936)