Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6120040
End position: 6120063
Length: 24

DNA sequence
>NC_020895, from 6120040 to 6120063 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGACGCTGACGCGGACGAGGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6119672-6120559	Sequence	SHJGH_5383 - secreted serine-rich protein (Protein is coded in complementary strand; from 6120559 to 6119672)