Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6229594
End position: 6229617
Length: 24

DNA sequence
>NC_020895, from 6229594 to 6229617 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGACCAGCGGAGCAGCGGACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6229562-6229699	Sequence	SHJGH_5487 - hypothetical protein (Protein is coded in complementary strand; from 6229699 to 6229562)