Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6236388
End position: 6236411
Length: 24

DNA sequence
>NC_020895, from 6236388 to 6236411 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGACGGTGACGGCGAGGGCGACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6236359-6237348	Sequence	SHJGH_5494 - integral membrane protein (Protein is coded in complementary strand; from 6237348 to 6236359)