Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6339586
End position: 6339609
Length: 24

DNA sequence
>NC_020895, from 6339586 to 6339609 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGGGCGCTGGCGCGGACGCTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6338217-6340064	Sequence	SHJGH_5600 - D-fructose-6-phosphate amidotransferase