Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6423042
End position: 6423065
Length: 24

DNA sequence
>NC_020895, from 6423042 to 6423065 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCTCCGTCTCCGCCGCCGTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6422632-6423507	Sequence	SHJGH_5674 - hypothetical protein (Protein is coded in complementary strand; from 6423507 to 6422632)