Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6551049
End position: 6551072
Length: 24

DNA sequence
>NC_020895, from 6551049 to 6551072 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGGAGTCGGAGTCGGAGTCGGAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6549842-6551104	Sequence	SHJGH_5774 - transport integral membrane protein (Protein is coded in complementary strand; from 6551104 to 6549842)